The code breaker, p.36

The Code Breaker, page 36

 

The Code Breaker
Select Voice:
Brian (uk)
Emma (uk)  
Amy (uk)
Eric (us)
Ivy (us)
Joey (us)
Salli (us)  
Justin (us)
Jennifer (us)  
Kimberly (us)  
Kendra (us)
Russell (au)
Nicole (au)



Larger Font   Reset Font Size   Smaller Font  



  “My dad will say, ‘My son Rufus, he’s bright but he’s mentally ill,’ ” Rufus told the American Masters interviewer. “Whereas I think of it as the opposite. I think I’m dim but not mentally ill.” He feels that he has let his father down. “It wasn’t until I became aware of how dim I was that I thought this was strange, because my dad’s not dim,” he says. “Then I thought that I’m a burden on my parents because he’s successful, and he deserves to have a successful child. He’s worked hard, and if you believe in karma he should have earned himself a successful son.”14

  At one point during my conversations with James Watson, when he veers toward the issue of race, Rufus bursts in from the kitchen shouting. “If you are going to let him say these things, then I am going to have to ask you to leave.” Watson merely shrugs and says nothing to his son, but he quits talking about race.15

  I can sense the intense protectiveness that Rufus feels toward his father. These outbursts also reveal in him a wisdom that his father often lacks. “My dad’s statements might make him out to be a bigot and discriminatory,” he once said. “They just represent his rather narrow interpretation of genetic destiny.” He’s right. In many ways he is wiser than his father.16

  CHAPTER 47 Doudna Pays a Visit

  Careful conversation

  As Watson requested, I ask Doudna if she would be willing to visit him during the meeting he was barred from attending. When the two of us enter his house, he asks to see the conference book with the abstracts of the scientific papers being presented. I am reluctant to show it to him because the cover of the book is Rosalind Franklin’s “photograph 51” X-ray diffraction image that helped Watson discover the structure of DNA. But he seems amused rather than upset. “Ah, that picture, it will always haunt me,” he says, then pauses and smiles his impish grin. “But she never figured out it was a helix.”1

  Watson, wearing a peach-colored sweater in the sun-dappled sitting room, points out some of the art he has collected over the years. Tellingly, his most prominent pieces are modernist and abstract depictions of human faces contorted in emotion. These include paintings and drawings by John Graham, André Derain, Wifredo Lam, Duilio Barnabé, Paul Klee, Henry Moore, and Joan Miró, as well as a drawing of Watson’s own slightly contorted and emotionally pensive face by David Hockney. Classical music plays in the background. Elizabeth Watson sits in the corner reading a book, and Rufus hovers out of sight in the kitchen, listening. Everyone tries to be careful in the conversation—even Watson, for the most part.

  Doudna talking with James Watson under his portrait

  “The reason that CRISPR is the most important discovery since DNA’s structure,” he tells Doudna, “is that it not only describes the world, as we did with the double helix, but makes it easy to change the world.” He and Doudna discuss the Watsons’ other son, Duncan, who lives in Berkeley near Doudna. “We were just there visiting him,” Watson says. “The students at Berkeley are the pits, they are so progressive. These progressive kids are even dumber than Republicans.” Elizabeth chimes in to change the subject.

  Doudna reminisces about the first meeting Watson had convened on genome editing at Cold Spring Harbor five years earlier, and how he had asked her a question from the audience. “I was enthusiastic about the use of it,” he says. “People who cannot think well enough will be able to be made immensely better.” Elizabeth again chimes in on a different topic.

  The complexity of human life

  It was a short visit, and as we walk back down the hill from Watson’s home, I ask Doudna her thoughts. “I was thinking back to when I was twelve and began reading the dog-eared copy of The Double Helix,” she says. “It would have been wild to know that years later I would be visiting with him in his home having that conversation.”

  She doesn’t say much else that day, but the visit resonated. Over the next few months, we would return to it in our conversations. “It was a poignant and sad visit,” she says. “He is clearly someone who has had a huge impact on biology and genetics, but he’s expressing views that are quite abhorrent.”

  She admits that she had mixed feelings about agreeing to go to see him. “But I agreed to because of his influence on biology and on my own life. Here’s a person who had this incredible career, and had this potential to be a real figure of respect in the field, and it was all squandered because of these views that he holds. Some people may say you shouldn’t have met with him. But for me it’s not so simple.”

  Doudna recalls one aspect of her father’s personality that used to upset her. Martin Doudna tended to categorize people as good or bad, with little respect for the shadings that most people contain. “He had people that he revered and thought were wonderful and they could do no wrong, and then he had people who were horrible and he disagreed with them on everything, and they could do no right.” Reacting to that, Doudna worked hard to see people in all of their complexity. “I felt like the world is kind of grayscale. There are people who have great qualities, but they also have flaws.”

  I mention “mosaic,” a term often used in biology. “That’s a better description than grayscale,” she says. “And frankly that’s true for all of us. All of us, if we’re honest with ourselves, know that we have things that we’re great at and things that we’re not so great at.”

  That indirect admission that we all have our flaws intrigued me. I tried to tease more out of her, asking how that applied to herself. “If I have a regret, it’s that I don’t really feel proud of the way I, in some cases, interacted with my dad,” she responds. “I got frustrated with him because he viewed people with a black-and-white lens.”

  Does that influence, I ask, how she tries to view James Watson? “I don’t want to do what my father did and come to simple judgments,” she answers. “I try to grapple with people who do great things, but who I also completely disagree with on some things.” Watson is a prime example, she says. “He has said some really bad things, but every time I see him, I am brought back to that day when I read The Double Helix and first started thinking, ‘Gee, I wonder if I could do that kind of science someday.’ ”2

  PART NINE Coronavirus

  I have no idea what’s awaiting me, or what will happen when this all ends. For the moment I know this: there are sick people and they need curing.

  —Albert Camus, The Plague, 1947

  CHAPTER 48 Call to Arms

  Innovative Genomics Institute

  At the end of February 2020, Doudna was scheduled to travel from Berkeley to Houston for a seminar. Life in the United States had not yet been disrupted by the looming coronavirus pandemic. There had been no officially reported deaths. But red flags were flying. There were already 2,835 deaths in China, and the stock market was beginning to take notice. The Dow fell more than a thousand points on February 27. “I was nervous,” Doudna recalls. “I talked with Jamie about whether or not to go. But at the time everyone I knew was carrying on as usual, and so I went to Houston.” She took with her a supply of hand wipes.

  When she returned, she began thinking about what she and her colleagues should be doing to fight the pandemic. Having turned CRISPR into a gene-editing tool, she had a profound feel for the molecular mechanisms that could be used by humans to detect and destroy viruses. More important, she had become a maestro of collaboration. It became clear to her that battling coronavirus would require putting together teams that spanned many specialties.

  Fortunately, she had a base from which she could build such an effort. She had become the executive director of the Innovative Genomics Institute (IGI), a joint research partnership between Berkeley and the University of California, San Francisco, with a spacious five-story modern building on the northwest corner of the Berkeley campus. (It was originally going to be called the Center for Genetic Engineering, but the university began to worry that the name might unnerve people.)1 One of the institute’s core principles is to foster collaboration between different fields, which is why its building houses plant scientists, microbial researchers, and biomedical specialists. Among the researchers who have their labs in the facility are her husband, Jamie; her original CRISPR collaborator Jillian Banfield; her former postdoc Ross Wilson; and the biochemist Dave Savage, who was using CRISPR to improve how bacteria in ponds convert carbon from the atmosphere into organic compounds.2

  Doudna had been talking to Savage, whose office is next to hers, for almost a year about launching some project at IGI that would become a model for cross-disciplinary teamwork. One genesis for the plan came from her son, Andy, who had a summer internship at a local biotech company. His day there began with a check-in where leaders from different divisions shared what they were doing to further the company’s projects. Hearing this, Doudna had laughed and told Andy she couldn’t imagine running an academic lab that way. “Why not?” he asked. She explained that academic researchers get comfortable in their silos and too protective of their independence. It started a long-running conversation in their house about teams, innovation, and how to create a work environment that stimulates creativity.

  She kicked around ideas with Savage in late 2019 at a Japanese noodle house in Berkeley. How could you combine, she asked, the best features of a corporate team culture with academic autonomy? They wondered if it would be possible to find a project that would coalesce researchers from a variety of labs around a single goal. They nicknamed the idea “Wigits,” for Workshop for IGI Team Science, and they joked that they would all join hands and build wigits together.

  When they floated the idea at one of the institute’s Friday happy hours, it met with enthusiasm from some of the students but not from most of the professors. “In industry everyone focuses on achieving agreed-upon common goals,” says Gavin Knott, one of the students eager to see this happen. “But in academia, everyone functions in their own bubble. We all work on our own research interests and we collaborate only when it’s necessary.” So with no source of funding and little faculty enthusiasm, the idea remained in limbo.3

  Then coronavirus came along. Savage’s students had been texting him to ask what Berkeley was doing to address the crisis, and he realized it could be the focus of the type of team approach they had discussed. When he wandered into Doudna’s office with the idea, he found that she had been thinking along the same lines.

  They agreed that she should call a meeting of their IGI colleagues and other Bay Area associates who might be interested in joining a coronavirus effort. That meeting, which is the one described in the introduction of this book, was at 2 p.m. on Friday, March 13—the day after Doudna and her husband made their predawn drive to Fresno to retrieve their son from his robotics competition.

  SARS-CoV-2

  The rapidly spreading new coronavirus had by then been given an official name: severe acute respiratory syndrome coronavirus 2, or SARS-CoV-2. It was so named because it was similar in its symptoms to the SARS coronavirus that spread out of China in 2003, infecting more than eight thousand people worldwide. The disease caused by the new virus was named COVID-19.

  Viruses are deceptively simple little capsules of bad news.I They are just a tiny bit of genetic material, either DNA or RNA, inside a protein shell. When they worm their way into a cell of an organism, they can hijack its machinery in order to replicate themselves. In the case of coronaviruses, the genetic material is RNA, Doudna’s specialty. In SARS-CoV-2, the RNA is about 29,900 base letters long, compared to more than three billion in human DNA. The viral sequence provides the code for making a mere twenty-nine proteins.4

  Here is a sample snippet of the letters in the coronavirus’s RNA: CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC. That sequence is part of a string that codes for making a protein that sits on the outside of the virus shell. The protein looks like a spike, which gives the virus, when viewed through an electron microscope, the appearance of a crown, hence corona. This spike is like a key that can fit into specific receptors on the surface of human cells. Notably, the first twelve letters of the sequence above allow the spike to bind very tightly to one specific receptor on human cells. This evolution of this short sequence explains how the virus could have jumped from bats to other animals to us.

  For the SARS-CoV-2 coronavirus, the human receptor is a protein known as ACE2. It plays a role that is similar to the one played for HIV by the CCR5 protein, which the rogue Chinese doctor He Jiankui edited out of his CRISPR twins. Because the ACE2 protein has functions other than just being a receptor, it’s probably not a good idea to try to edit it out of our species.

  The new coronavirus jumped into humans sometime in late 2019. The first officially certified death was reported on January 9, 2020. Also on that day, Chinese researchers publicly posted the full genetic sequence of the virus. Using cryo-electron microscopy, which fires electrons at proteins that have been frozen in a liquid, structural biologists were able to create a precise model, atom by atom and twist by twist, of the coronavirus and its spikes. With the sequencing information and structural data in hand, molecular biologists began racing to find treatments and vaccines that would block the ability of the virus to latch on to human cells.5

  The order of battle

  The March 13 meeting that Doudna summoned drew far more participants than she and Savage expected. A dozen key lab leaders and students gathered that Friday afternoon in the ground-floor conference room of the IGI building just as the rest of the campus was being locked down. Another fifty researchers from the Bay Area joined by Zoom. “Without planning it or imagining how it would come about,” Doudna says, “our idea from the noodle house became reality.”6

  As Doudna discovered, there is an advantage to being part of large organizations such as UC Berkeley and the IGI. Innovation often happens in garages and dorm rooms, but it is sustained by institutions. An infrastructure is needed to handle the logistics required for complex projects. This is especially true during a pandemic. “Having the IGI in place was incredibly useful,” Doudna says, “because there were teams of people who could help with things like writing proposals, setting up Slack channels, sending out group emails, arranging Zoom meetings, and coordinating equipment.”

  Berkeley’s legal team came up with a policy for sharing discoveries freely with other coronavirus researchers while protecting the underlying intellectual property. At one of the first meetings, a university lawyer laid out a template for royalty-free licensing. “We will allow non-exclusive no-fee licensing of any of the work that’s coming out of this effort,” she said. “We still want to file for patent protection for anything discovered, but then we will make it available for this purpose.” Doudna had a slide presentation on this for the group’s second Zoom meeting, held on March 18. She summarized its message succinctly: “It’s not about making money here.”

  By the time of this second meeting, Doudna also had a slide listing ten projects they had decided to pursue, with the names of the team leaders. Some of the planned tasks made use of the latest CRISPR technology, including developing a CRISPR-based diagnostic test and finding ways to deliver safely into the lungs a CRISPR-based system that could target and destroy the genetic material of the virus.

  When the ideas first started rolling in, one of the wise hands in the room, a professor named Robert Tjian, had interjected a note of clarity. “Let’s split this in two parts,” he said. There are new things we could try to invent, “but first there’s the fire-on-my-ass problem.” There was a pause for a moment, then he explained. They had to deal with the urgent need for public testing before they could sit at their lab benches and come up with biotechnologies for the future. So the first team Doudna launched was given the mission of converting a space on the ground floor of the building, near where they were seated, into a state-of-the-art, high-speed, automated coronavirus testing lab.

  I. Yes, the world is filled with some very useful and necessary viruses, but they are for a different book.

  Fyodor Urnov getting the first test samples from Dori Tieu of the Berkeley Fire Department as Dirk Hockemeyer watches

  CHAPTER 49 Testing

  America’s failure

  The first official guidance to local health officials in the U.S. about testing for the new coronavirus came in a conference call on January 15, 2020, led by Stephen Lindstrom, a microbiologist at the Centers for Disease Control (CDC). The CDC had developed a test for the new coronavirus, he said, but it could not make it available to state health departments until the Food and Drug Administration (FDA) approved it. That should be soon, Lindstrom promised, but until then, doctors would have to send samples to the CDC in Atlanta for testing.

  The next day, a Seattle doctor sent the CDC a nose-swab sample from a thirty-five-year-old man who had returned from a visit to Wuhan and come down with flu-like symptoms. He became the first person in the U.S. to test positive.1

  On January 31, Health and Human Services Secretary Alex Azar, whose department oversees the FDA, declared a public health emergency. The declaration gave the FDA the right to speed up approvals for coronavirus tests. But it had a weird unintended consequence. In normal circumstances, hospitals and university labs can devise their own tests to use at their facilities, as long as they do not market them. But a declaration of a public health emergency imposes the requirement that such tests not be used until they get an “emergency use authorization.” The intent is to avoid the use of unproven tests during a health crisis. As a result, Azar’s declaration triggered new restrictions on academic labs and hospitals. That would have been fine if the CDC’s test was widely available. But the FDA had still not approved it.

 

Add Fast Bookmark
Load Fast Bookmark
Turn Navi On
Turn Navi On
Turn Navi On
Scroll Up
Turn Navi On
Scroll
Turn Navi On
183