Goliath, p.1

Goliath, page 1

 

Goliath
Select Voice:
Brian (uk)
Emma (uk)  
Amy (uk)
Eric (us)
Ivy (us)
Joey (us)
Salli (us)  
Justin (us)
Jennifer (us)  
Kimberly (us)  
Kendra (us)
Russell (au)
Nicole (au)



Larger Font   Reset Font Size   Smaller Font  


Goliath


  Goliath

  Steve Alten

  Commander Rochelle "Rocky" Jackson is aboard the aircraft carrier USS Ronald Reagan when the "unsinkable" naval vessel and its entire fleet are attacked from the depths and sunk. As Rocky struggles to stay alive, a monstrous mechanical steel stingray surfaces, plowing through the seas it now commands.

  A U.S. Navy-designed futuristic nuclear stealth submarine the length of a football field in the shape of a giant stingray. Simon Covah, a brilliant scientist whose entire family were the victims of terrorism has hijacked the sub. Believing violence is a disease, Covah aims to use the Goliath and its cache of nuclear weapons to dictate policy to the world regarding the removal of oppressive regimes and nuclear weapons.

  Could the threat of violence forge a lasting peace?

  But there is another player in this life-and-death chess match. Unbeknownst to Covah and the Goliath crews, Sorceress, the Goliath's biochemical computer brain has become self-aware.

  And that computer brain is developing its own agenda.

  EPILOGUE

  Copyright Page

  Dedicated

  to the officers and men, past and present,

  of the United States Submarine Force.

  And to my sister, Abby,

  for inspiring me to write.

  “We are on the precipice of the next great leap in computer technology. The chemically assembled electronic nanocomputer, or CAEN, will be billions of times faster than our current PCs and represent the forefront of artificial intelligence.”

  —Dr. Elizabeth Goode

  “There’s a fine line between right and wrong, freedom and oppression, the best of intentions and the insanity of genocide.”

  —Gunnar Wolfe

  “History is a bloodbath.”

  —Williams James

  “No snowflake in an avalanche ever feels responsible.”

  —Unknown

  PROLOGUE

  Identity: Stage One: am small and insignificant, stranded on the vast expanse of nature. I hope I can survive.

  —Deepak Chopra

  “Come to course zero-nine-zero, ahead one-third. Make ship’s depth fifty meters.”

  “Aye, sir, coming to course zero-nine-zero, making ship’s depth fifty meters.”

  “Engage computer.”

  “Aye, sir, computer engaged.”

  010110100100100101101101101001010110100101101010101

  001011010101101010101110010101100101010110100101101010

  110110111101001010110101011010010101101001010100101

  “Mr. Chau. Prepare to bring Sorceress on-line. Flood nutrient womb. Prepare bacteria for injection.”

  “Aye, sir. Nutrient womb flooded. Bacteria ready for injection.”

  “Inject bacteria into womb. Engage DNA synthesizers.”

  “Aye, sir. Injecting bacteria. Engaging DNA synthesizers.”

  0101101001011010100101011010 1011010 1 1 0 0 1 0 1 ATCGATC-

  GATATACCAG

  “Activate sensor orbs. Activate voice recognition and response programs.”

  “Aye, sir. Sensor orbs activated. Voice recognition and response programs on-line.”

  “Transfer primary ship’s control to computer. Sorceress, this is Covah. Are you on-line?”

  AACGTTTGTACCACATTAGGATACACATTAGGATA ACA GT A A

  TG C A A

  “Sorceress, acknowledge.”

  ACKNOWLEDGED. SORCERESS ON-LINE.

  “The people who get on in this world are the people who get up and look for the circumstances they want, and if they can’t find them—make them.”

  —George Bernard Shaw

  “Revolutions happen, above all, in the minds of men.”

  —Ralph Peters, “Fighting for the Future”

  “Do we have to shed blood to reform the current political system? I hope it doesn’t have to come to that. But it might.”

  —Timothy J. McVeigh, former Army sergeant who bombed the Murrah Federal Building in Oklahoma City, Oklahoma

  “The enemy is in many places. The enemy is not looking to be found. And so you have to design a campaign plan that goes after that kind of enemy … .”

  —Colin Powell, U.S. Secretary of State

  CHAPTER 1

  25 September Atlantic Ocean Seine Abyssal Plain 112 miles southwest of the Strait of Gibraltar

  With an expulsion of air and water, the majestic behemoth breaks the surface, her sickle-shaped dorsal fin cutting the waves, her great tail slapping the sea in defiance before slipping back into the froth.

  At 120 tons, the blue whale is easily the largest living organism ever to have existed on the planet, often reaching lengths of one hundred feet or more. Ten tons of blood surge through its body, driven by a heart the size of a small car. Despite its prodigious girth, the mammal is not a predator but a forager of minifauna, thriving on a diet of krill and crustaceans, which it sieves from the water through its baleen plates.

  The adult female rises again, guiding her two-month-old calf to a labored breath above the storm-threatened seas.

  A thousand feet below, an ominous presence moves silently through the depths. Demonic scarlet eyes, pupil-less and unblinking, blaze luminescent through the blackness of the abyss. Its gargantuan torso, cloaked in the darkness, scatters every creature in its path.

  Sensing a disturbance above, the creature banks sharply away from the seafloor and rises, homing in on the mother blue and her calf.

  The leviathan ascends, its bulk piercing the swaying gray curtains of the shallows, the filtered rays of sunlight revealing the enormous winged contours of a monstrous stingray. So quiet is the predator that the adult blue whale fails to detect its presence until it is nearly upon them. In a sudden frenzy of movement, the startled mother slaps her fluke and pushes her newborn below, rolling on top of her offspring to shield it from the jowls of the hunter.

  The ungodly behemoth pursues, its flat, triangular mouth remaining close to the gyrating tails of the frightened mammals.

  Yet the beast does not attack. Maneuvering through a trail of bubbles, it keeps the tip of its snout within a fin’s length of the adult’s thrashing fluke, taunting its quarry in a terrifying game of cat and mouse. Hunted and hunter race through the thermocline, the thin layer of water separating the sunwarmed surface waters from the colder depths.

  In due time, the leviathan tires of the chase. With a burst of speed, it soars beneath its terrified prey, buffeting them in its wake as it returns once more to the silence of the depths.

  Darkness and cold envelop the devilfish, black, save for the hellish glow surrounding its unearthly eyes. At nine hundred feet it levels out, its streamlined bulk creating barely a ripple. Gliding high above the desolate floor of the abyssal plain, it continues its journey west, homing in on its true quarry.

  Atlantic Ocean: 235 nautical miles due west of the Strait of Gibraltar

  15:12 hours

  Sailing beneath a mouse gray autumn sky, the United States aircraft Carrier Ronald Reagan (CVN-76) plows through the sea, its steel bow cutting a path through the twelve-foot swells at a steady twenty knots.

  Belowdecks, Captain James Robert Hatcher, the fifty-two-year-old commanding officer of the Ronald Reagan, ignores the grins of his crew as he vacates the exercise room and double-times it down one of the ship’s two central passageways. Ducking deftly through a dozen watertight hatches and knee-knockers, he arrives in “blue tile country,” the central command-andcontrol complex for the aircraft carrier and its battle group.

  The Ronald Reagan is a veritable fortress of modern-day warfare. One thousand feet long, with an island infrastructure towering twenty stories above the waterline, the Nimitz-class “supercarrier” is by far the largest and heaviest object at sea, weighing in at ninety-seven thousand tons. Despite its mammoth girth, the ship is fast, its four twenty-one-foot-wide bronze propellers, powered by two nuclear reactors, able to drive the vessel seven hundred nautical miles a day at speeds in excess of thirty knots.

  The supercarrier and its fleet project the awesome forward presence and might of the United States Armed Forces. On its roof lies a four-and-a-half acre airport, managed by a city of six thousand men and women. Positioned along its flattop and in the hangar deck below are more than seventy aircraft, including two squadrons of F/A-18E and 18F Super Hornets, eight CSA (Common Support Aircraft) designed for electronics, communications, intelligence, refueling, and antisubmarine warfare, four AEW (Airborne Early Warning) Surface Surveillance craft, and a squadron of fourteen brand-new, Stealth Joint Strike Fighters (JSFs). Carrying a multitude of offensive weapons, the “swarm” literally sews up all of the CVBG’s airspace.

  The carrier’s defensive weaponry includes the Evolved Sea Sparrow shortrange surface-to-air missile (ESSM), three eight-round Mk-29 Sea Sparrow SAM launchers, the SLQ-32 electronic warfare system, and the Vulcan Phalanx close-in missile defense system, a rapid-fire gun capable of shooting nine hundred rounds per second of 20-mm ammunition.

  Along with its own defenses, the carrier travels within a multilayered battle group (CVBG), making it nearly invincible on the open sea. Surrounding the Ronald Reagan are sixteen combat ships, ten support ships, and two Los Angeles-class attack subs, the USS Jacksonville, (SSN-699) and the USS Hampton (SSN-767). Positioned along either side of the Ronald Reagan are her two 567-foot Ticonderoga-class escorts, the USS Leyte Gulf and the USS Yorktown.

  The two guided-missile cruisers share one mission: protect the aircraft carrier at all costs. Each warship is equipped with the Aegis Theater High-Altitude Air Defense (THADD) program, a highly sophisticated battle-management system designed to shield the carrier from attack. Utilizing an array of sensor fusion computers, the THADD system integrates onboard radar, sonar, and laser systems with its weapons, utilizing recent and real-time overhead sat-data in order to assess enemy threats. Coordinated multistatic radar make it impossible for enemy stealth aircraft or cruise missiles to penetrate undetected, while its multitasking parallel computers can assign priorities and engage incoming targets in the blink of an eye. In addition to its guns, torpedoes, and a full suite of chaff and flares designed to decoy incoming missiles, the two Ticonderogas are also equipped with Tomahawk cruise missiles—long-range projectiles capable of destroying targets up to a thousand miles away.

  The United States maintains twelve carrier battle groups, usually deploying only two or three at any given time. In addition to its conventional weapons, the Ronald Reagan is the first aircraft carrier in more than a decade to carry a limited number of nuclear warheads, a policy change dictated by Russia’s and China’s recent push in the nuclear arms race, spurred on by United States insistence on moving ahead with its own Missile Defense Shield.

  Captain Hatcher makes his way into the Combat Information Center (CIC), the heavily air-conditioned confines of the darkened chamber quickly cooling his sweaty, half-naked physique. A dozen technicians glance up from their computer screens as the CO walks by. Hatcher takes a quick look around, then spots his executive officer, Commander Shane Strejcek.

  “XO, have you seen Bob Lawson?”

  “The congressman? Yes, sir, he was speaking with Commander Jackson about ten minutes ago.”

  Hatcher proceeds to the central alcove of sensor consoles that encircle a large high-resolution Plexiglas digital display in map mode, depicting the North Atlantic and the Mediterranean Sea. The carrier battle group’s position and surrounding defense zones are color-coded in fluorescent blue, her aircraft in pulsing green, the topography of Europe and West Africa in steady red. Within the multilayered transparent display, both ocean conditions or atmospheric weather status can be shown.

  Commander Rochelle “Rocky” Jackson looks up from her sonar console as her CO approaches, tufts of her short, straw-colored blond hair peeking out from beneath the navy baseball cap. “Nice legs, Hatch.”

  The heavy air-conditioning is causing Rocky’s nipples to press against the inside of her tee shirt. Hatcher catches himself staring. “Commander, what are you doing working at a station?”

  “Ensigns Soderblom and Dodds are out with the flu. You looking for Congressman Lawson?”

  “I take it I just missed him.”

  “By a good twenty minutes. I tried to entertain him. Guess he got bored.”

  “I’m sure it wasn’t from the view. If you’re cold, Commander, I can get you a sweater.”

  She smirks, buttoning her jacket, her hazel eyes sparkling in the console’s glow. “I’m fine. Thank you, sir.”

  Hatcher leans down, whispering in her ear. “By the way, Commander, happy birthday.”

  Her high cheekbones swell with a smile. She turns back to face the sonar screen. “Go away,” she whispers to her husband, “I’m on duty, and you smell. As for Lawson, try Vulture’s Row.”

  “Thanks.”

  Rocky watches Hatcher leave the Command Center, the sight of the sweat lines running down the fanny seam of his gray Navy-issue shorts causing her to grin.

  Commander Rochelle Megan Jackson made her entry into this world thirty-four years and seven hours ago at the Army Base Medical Center in Fort Benning, Georgia. Fully anticipating the arrival of a son, her father, Michael “Bear” Jackson, then a lieutenant colonel with the elite United States Rangers, nevertheless presented his newborn with a baseball glove, football, and his own father’s first name, Rocky, which her mother immediately changed on the birth certificate to Rochelle.

  Rocky would be an only child, the product of an interracial, interservice marriage. Her father, whom she affectionately called “Papa Bear,” was career Army all the way. The Bear was a barrel-chested light-skinned African American with a short-cropped auburn Afro and broad smile, who had earned his nickname during his years as a commando in the Army’s Special Forces. Those who served under him knew his bark was worse than his bite, Jackson’s gruff personality hiding a deep loyalty toward his men. Rocky’s mother, Judy, on the other hand, was as quiet as the Bear was loud. A white Anglo-Saxon Protestant, Judy had earned her engineering degree at M.I.T., and had been heavily recruited by the United States Navy. She would meet her future husband in Washington, D.C., during a weeklong munitions convention.

  Rocky Jackson might as well have enlisted at birth.

  Growing up on a military base with other Army “brats,” Rocky soon began displaying her father’s overly competitive spirit. The fair-headed tomboy not only challenged her male classmates on the athletic fields, but more often than not came out the victor. Much of her “need to exceed” attitude was intended to please Papa Bear, who could always be found hooting and hollering from the Little League bleachers, that is, when he wasn’t traveling abroad on some covert mission.

  While her father’s “Special Forces mentality” gave Rocky an edge in athletics, her overly competitive attitude did not mix well in her social life. As she blossomed into adolescence, the beautiful blond teen with the cocoa skin and Jackie Joyner-Kersey physique often intimidated guys and girls alike. Even when she did date, her no-nonsense attitude toward sex quickly earned her a reputation as a prude. This was not to say that Rocky didn’t have the usual adolescent desires—it was just that she was picky. Whoever she might eventually give herself to would have to be able to measure up to Papa Bear, and none of the so-called hotshots at her high school ever did. When her prom date, the school’s starting tailback, decided to push things a bit too far on the dance floor, she calmly reared back and punched the high school all-American in the face, her powerful well-practiced tae kwon do jab shattering his nose.

  Though Rocky’s physical prowess and leadership style may have reflected the personality of her father, her academic pursuits were strictly guided by her mother, herself a former engineering student. After graduating with honors from the Naval Academy, Rocky entered M.I.T.’s engineering school, her advanced degree eventually leading to a high-ranking position in the Naval Undersea Warfare Engineering Center (NUWC), in Keyport, Washington.

  The military was Rocky’s life, but she had no desire to command in the field. As the Gulf War had demonstrated, technology was the key to America’s dominance as a world power, and Rocky wanted to ride the wave that guaranteed her country’s freedom for decades to come. Her ego-driven career goal was simple: She would immerse herself in as many new hyperadvanced technologies available, learning all she could from the country’s top engineers, and rub elbows with all her father’s “muckety-muck” friends in the Pentagon until the opportunity came to oversee one of the Navy’s new high-tech weapon systems.

  Her opportunity would come following several long years working on the Navy’s new SSN Virginia-class attack sub. George W. Bush’s victory had pushed the space-based missile defense shield to the top of the White House’s military wish list. Only six months later, the defection of Vermont senator Jim Jeffords from the Republican Party returned control of the Senate to the Democrats, threatening to send the high-tech, high-cost defense initiative back into development hell. A new project was needed, something more feasible and easier to digest financially, while still packing a wallop regarding America’s national security.

  Enter the GOLIATH Project, a top-secret venture carrying a price tag in excess of $10 billion. Unlike SDI, this would be an offensive machine developed by NUWC, a machine capable of altering the strategy of America’s Armed Forces for decades to come—and she was the top candidate in line for the directorship.

 

Add Fast Bookmark
Load Fast Bookmark
Turn Navi On
Turn Navi On
Turn Navi On
Scroll Up
Turn Navi On
Scroll
Turn Navi On
183